|
ATCC
cell lines hct116 cells atcc ccl 247 oligonucleotides sirna targeting sequence Cell Lines Hct116 Cells Atcc Ccl 247 Oligonucleotides Sirna Targeting Sequence, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm41732277-212-2-6?v=ATCC Average 99 stars, based on 1 article reviews
cell lines hct116 cells atcc ccl 247 oligonucleotides sirna targeting sequence - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
Cyagen Biosciences
s cko 06892 oligonucleotides sirna sequences S Cko 06892 Oligonucleotides Sirna Sequences, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm41519131-224-213-210?v=Cyagen+Biosciences Average 94 stars, based on 1 article reviews
s cko 06892 oligonucleotides sirna sequences - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Addgene inc
nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm41339559-650-18-29?v=Addgene+inc Average 96 stars, based on 1 article reviews
nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
lentiviral shrna oligonucleotide sequences Lentiviral Shrna Oligonucleotide Sequences, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pmc12581445-54-9-15?v=Obio+Technology+Corp+Ltd Average 86 stars, based on 1 article reviews
lentiviral shrna oligonucleotide sequences - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Addgene inc
oligonucleotides shrna sequences Oligonucleotides Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pmc11228649__mmc2-510-228-260?v=Addgene+inc Average 96 stars, based on 1 article reviews
oligonucleotides shrna sequences - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
oligonucleotide sequences of lentiviral shrnas Oligonucleotide Sequences Of Lentiviral Shrnas, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pmc12211798-40-5-19?v=Obio+Technology+Corp+Ltd Average 90 stars, based on 1 article reviews
oligonucleotide sequences of lentiviral shrnas - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Addgene inc
shrna oligonucleotide sequences ![]() Shrna Oligonucleotide Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/bio_rxiv__2025__05__16__654502-188-11-18?v=Addgene+inc Average 96 stars, based on 1 article reviews
shrna oligonucleotide sequences - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Addgene inc
oligonucleotide pairs encoding shrna sequences ![]() Oligonucleotide Pairs Encoding Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/bio_rxiv__2025__05__08__652299-398-5-22?v=Addgene+inc Average 96 stars, based on 1 article reviews
oligonucleotide pairs encoding shrna sequences - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Cyagen Biosciences
s ko 20355 oligonucleotides sirna targeting sequence ![]() S Ko 20355 Oligonucleotides Sirna Targeting Sequence, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm40112809-674-73-71?v=Cyagen+Biosciences Average 93 stars, based on 1 article reviews
s ko 20355 oligonucleotides sirna targeting sequence - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
Journal: bioRxiv
Article Title: EWSR1::ETS-low cells promote metabolic reprogramming of the tryptophan-kynurenine-AHR axis, immunosuppression, and poor outcome in Ewing sarcoma
doi: 10.1101/2025.05.16.654502
Figure Lengend Snippet: a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible shRNA targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.
Article Snippet: AHR silencing (transcript ID: Human NM_001621.5) was achieved by cloning the
Techniques: Activity Assay, Two Tailed Test, Co-Culture Assay, MANN-WHITNEY, Expressing, Clone Assay, shRNA, Western Blot