Review





Similar Products

99
ATCC cell lines hct116 cells atcc ccl 247 oligonucleotides sirna targeting sequence
Cell Lines Hct116 Cells Atcc Ccl 247 Oligonucleotides Sirna Targeting Sequence, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm41732277-212-2-6?v=ATCC
Average 99 stars, based on 1 article reviews
cell lines hct116 cells atcc ccl 247 oligonucleotides sirna targeting sequence - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

94
Cyagen Biosciences s cko 06892 oligonucleotides sirna sequences
S Cko 06892 Oligonucleotides Sirna Sequences, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm41519131-224-213-210?v=Cyagen+Biosciences
Average 94 stars, based on 1 article reviews
s cko 06892 oligonucleotides sirna sequences - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

96
Addgene inc nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt
Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm41339559-650-18-29?v=Addgene+inc
Average 96 stars, based on 1 article reviews
nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

86
Obio Technology Corp Ltd lentiviral shrna oligonucleotide sequences
Lentiviral Shrna Oligonucleotide Sequences, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pmc12581445-54-9-15?v=Obio+Technology+Corp+Ltd
Average 86 stars, based on 1 article reviews
lentiviral shrna oligonucleotide sequences - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

96
Addgene inc oligonucleotides shrna sequences
Oligonucleotides Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pmc11228649__mmc2-510-228-260?v=Addgene+inc
Average 96 stars, based on 1 article reviews
oligonucleotides shrna sequences - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
Obio Technology Corp Ltd oligonucleotide sequences of lentiviral shrnas
Oligonucleotide Sequences Of Lentiviral Shrnas, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pmc12211798-40-5-19?v=Obio+Technology+Corp+Ltd
Average 90 stars, based on 1 article reviews
oligonucleotide sequences of lentiviral shrnas - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
Addgene inc shrna oligonucleotide sequences
a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible <t>shRNA</t> targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.
Shrna Oligonucleotide Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/bio_rxiv__2025__05__16__654502-188-11-18?v=Addgene+inc
Average 96 stars, based on 1 article reviews
shrna oligonucleotide sequences - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

96
Addgene inc oligonucleotide pairs encoding shrna sequences
a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible <t>shRNA</t> targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.
Oligonucleotide Pairs Encoding Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/bio_rxiv__2025__05__08__652299-398-5-22?v=Addgene+inc
Average 96 stars, based on 1 article reviews
oligonucleotide pairs encoding shrna sequences - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
Cyagen Biosciences s ko 20355 oligonucleotides sirna targeting sequence
a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible <t>shRNA</t> targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.
S Ko 20355 Oligonucleotides Sirna Targeting Sequence, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+oligonucleotide+sequences/pm40112809-674-73-71?v=Cyagen+Biosciences
Average 93 stars, based on 1 article reviews
s ko 20355 oligonucleotides sirna targeting sequence - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results


a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible shRNA targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.

Journal: bioRxiv

Article Title: EWSR1::ETS-low cells promote metabolic reprogramming of the tryptophan-kynurenine-AHR axis, immunosuppression, and poor outcome in Ewing sarcoma

doi: 10.1101/2025.05.16.654502

Figure Lengend Snippet: a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible shRNA targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.

Article Snippet: AHR silencing (transcript ID: Human NM_001621.5) was achieved by cloning the shRNA oligonucleotide sequences into the Tet-pLKO-puro backbone (Addgene #21915, USA).

Techniques: Activity Assay, Two Tailed Test, Co-Culture Assay, MANN-WHITNEY, Expressing, Clone Assay, shRNA, Western Blot